| exactWord {GeneR} | R Documentation |
Gets match positions of an oligomer in fragments of a sequence
exactWord(word, seqno=0, from=1, to=0, strand = getStrand(), step=1, overlap=TRUE, wNbOcc =-1,case.sensitive=FALSE)
word |
string/scalar, Oligomer sequence |
seqno |
Integer/scalar, Sequence number (buffer number) |
from, to |
Integer/scalar, Absolute addresses of the beginning and the end of the fragment, (1 means the first nucleotide and 0 conventionally the last one; from must not be larger than to and both vectors must be the same size) |
step |
Integer/scalar, Size of the step in which search progression is done |
overlap |
TRUE: look for overlapping oligomer |
wNbOcc |
Integer/scalar, Maximum number of occurences to retrieve sequentially in each fragment (-1 -> all) |
strand |
Integer/scalar, Strand (forward: 0, reverse: 1) |
case.sensitive |
T -> difference between lower and upper case letter, F -> no difference |
A list of match positions in each fragment. If error : NULL.
step with negative values will be implemented soon
L.Cottret
s<-"cgtagctagctagctagctagctagctagcta"
placeString(s)
exactWord(word="ag", from=c(3,11,23),to=c(9,17,29))
#[[1]]
#[1] 4 8
#
#[[2]]
#[1] 12 16
#
#[[3]]
#[1] 24 28
placeString("TTTTTTTTTTTT")
exactWord("TTT")
exactWord("TTT",overlap=FALSE,step=2)