trimLRPatterns {Biostrings}R Documentation

Trim Flanking Patterns from Sequences

Description

The trimLRPatterns function trims left and/or right flanking patterns from sequences.

Usage

trimLRPatterns(Lpattern = "", Rpattern = "", subject,
               max.Lmismatch = 0, max.Rmismatch = 0,
               with.Lindels = FALSE, with.Rindels = FALSE,
               Lfixed = TRUE, Rfixed = TRUE, ranges = FALSE)

Arguments

Lpattern The left pattern.
Rpattern The right pattern.
subject An XString object, XStringSet object, or character vector containing the target sequence(s).
max.Lmismatch Either an integer vector of length nLp = nchar(Lpattern) representing an absolute number of mismatches (or edit distance if with.Lindels is TRUE) or a single numeric value in the interval [0, 1) representing a mismatch rate when aligning terminal substrings (suffixes) of Lpattern with the beginning (prefix) of subject following the conventions set by neditStartingAt, isMatchingStartingAt, etc.

When max.Lmismatch is 0L or a numeric value in the interval [0, 1), it is taken as a "rate" and is converted to as.integer(1:nLp * max.Lmismatch), analogous to agrep (which, however, employs ceiling).

Otherwise, max.Lmismatch is treated as an integer vector where negative numbers are used to prevent trimming at the i-th location. When an input integer vector is shorter than nLp, it is augmented with enough -1s at the beginning to bring its length up to nLp. Elements of max.Lmismatch beyond the first nLp are ignored.

Once the integer vector is constructed using the rules given above, when with.Lindels is FALSE, max.Lmismatch[i] is the number of acceptable mismatches (errors) between the suffix substring(Lpattern, nLp - i + 1, nLp) of Lpattern and the first i letters of subject. When with.Lindels is TRUE, max.Lmismatch[i] represents the allowed "edit distance" between that suffix of Lpattern and subject, starting at position 1 of subject (as in matchPattern and isMatchingStartingAt).

For a given element s of the subject, the initial segment (prefix) substring(s, 1, j) of s is trimmed if j is the largest i for which there is an acceptable match, if any.

max.Rmismatch Same as max.Lmismatch but with Rpattern, along with with.Rindels (below), and its initial segments (prefixes) substring(Rpattern, 1, i).

For a given element s of the subject, with nS = nchar(s), the terminal segment (suffix) substring(s, nS - j + 1, nS) of s is trimmed if j is the largest i for which there is an acceptable match, if any.

with.Lindels If TRUE, indels are allowed in the alignments of the suffixes of Lpattern with the subject, at its beginning. See the with.indels arguments of the matchPattern and neditStartingAt functions for detailed information.
with.Rindels Same as with.Lindels but for alignments of the prefixes of Rpattern with the subject, at its end. See the with.indels arguments of the matchPattern and neditEndingAt functions for detailed information.
Lfixed, Rfixed Whether IUPAC extended letters in the left or right pattern should be interpreted as ambiguities (see ?`lowlevel-matching` for the details).
ranges If TRUE, then return the ranges to use to trim subject. If FALSE, then returned the trimmed subject.

Value

A new XString object, XStringSet object, or character vector with the "longest" flanking matches removed, as described above.

Author(s)

P. Aboyoun and H. Jaffee

See Also

matchPattern, matchLRPatterns, lowlevel-matching, XString-class, XStringSet-class

Examples

  Lpattern <- "TTCTGCTTG"
  Rpattern <- "GATCGGAAG"
  subject <- DNAString("TTCTGCTTGACGTGATCGGA")
  subjectSet <- DNAStringSet(c("TGCTTGACGGCAGATCGG", "TTCTGCTTGGATCGGAAG"))

  ## Only allow for perfect matches on the flanks
  trimLRPatterns(Lpattern = Lpattern, subject = subject)
  trimLRPatterns(Rpattern = Rpattern, subject = subject)
  trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet)

  ## Allow for perfect matches on the flanking overlaps
  trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet,
                 max.Lmismatch = 0, max.Rmismatch = 0)

  ## Allow for mismatches on the flanks
  trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subject,
                 max.Lmismatch = 0.2, max.Rmismatch = 0.2)
  maxMismatches <- as.integer(0.2 * 1:9)
  maxMismatches
  trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet,
                 max.Lmismatch = maxMismatches, max.Rmismatch = maxMismatches)

  ## Produce ranges that can be an input into other functions
  trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subjectSet,
                 max.Lmismatch = 0, max.Rmismatch = 0, ranges = TRUE)
  trimLRPatterns(Lpattern = Lpattern, Rpattern = Rpattern, subject = subject,
                 max.Lmismatch = 0.2, max.Rmismatch = 0.2, ranges = TRUE)
[Package Biostrings version 2.20.1 Index]