| randomSeq {GeneR} | R Documentation |
Function randomSeq creates a random sequence from a
distribution of nulcleotides, of poly-nucleotides. A real
composition of nucleotides can be use from function
compoSeq, with param p=TRUE.
ShuffleSeq creates a sequence while assembling
at random specific number of each nucleotides (or poly-nucleotides).
These number of nucleotide can be provided by function
compoSeq, with param p=FALSE: it is then a re-assemblage
of all nucleotides (or tri-nucleotides, or poly-nucleotides)
of a real sequence.
randomSeq(prob = c(0.25, 0.25, 0.25, 0.25, 0), letters = c("T", "C",
"A", "G", "N"), n )
shuffleSeq(count,letters=c("T","C","A","G","N"))
prob |
A vector of probability weights for obtaining the elements of the vector being sampled or a result from compoSeq function (with option p=TRUE. |
count |
A vector of number of repetitions for each letters (or bi-tri nucleotides, must be of same length as letters) or a result from compoSeq function (with option p=FALSE). |
letters |
Letters (or bi-tri nucleotides) to be sampled |
n |
Integer giving the number of items to choose. |
A character string (sequence) or NULL.
A. Lucas
## Set seed of your choice (not requiered)
set.seed(3)
#### ---- RANDOMSEQ ----
## Create a sequence of size 30, GC rich
randomSeq(prob = c(0.20, 0.30, 0.20, 0.30), letters = c("T", "C","A", "G"), n = 30)
## [1] "CTGGAACCGAGGGGTTCATCCCCCCAGTGA"
## use with bi-nucleotides
randomSeq(prob=rep(0.0625,16),letters = c("TT","TC","TA","TG","CT","CC","CA","CG","AT","AC","AA","AG","GT","GC","GA","GG"),n=10)
## [1] "CGCATGATCCCAGGCTAACT"
#### ---- SHUFFLESEQ ----
## Create a sequence with 7 T, 3 C and A, and 4 G.
shuffleSeq(count=c(7,3,3,4,0),letters=c("T","C","A","G","N"))
## [1] "TATCTTTTGTCGGACGA"
## Same with bi-nucleotides
shuffleSeq(count=c(rep(4,4),rep(2,4),rep(1,4),rep(0,4)),letters = c("TT","TC","TA","TG","CT","CC","CA","CG","AT","AC","AA","AG","GT","GC","GA","GG"))
## [1] "TCTTTCCATTCCTTCTAGTGTACCCGTATACGTGTCTGTGTACTTCAACAACTTAT"
## From a real sequence:
## WARNING: Because NCBI changed the web service the seqNcbi() function
## needs to connect to, the function is broken. Please contact
## the maintainer of the GeneR package about this. Thanks!
if (interactive()) {
seqNcbi("BY608190",file="BY608190.fa")
readFasta("BY608190.fa")
## create a random sequence from a real tri-nucleotides distribution
## Size of sequence will be 10*3.
randomSeq(compoSeq(wsize=3,p=TRUE),n=10)
## re assemble real tri-nucleotides of a real sequence
shuffleSeq(compoSeq(wsize=3,from=1,to=30,p=FALSE))
}