| complementSeq {Biostrings} | R Documentation |
WARNING: complementSeq has been
deprecated in favor of complement.
Function to obtain the complementary sequence.
complementSeq(seq, start=1, stop=0)
seq |
Character vector consisting of the letters A, C, G and T. |
start |
Numeric scalar: the sequence position at which to start complementing. If 1, start from the beginning. |
stop |
Numeric scalar: the sequence position at which to stop complementing. If 0, go until the end. |
The complemented sequence for each element of the input is computed and returned. The complement is given by the mapping: A -> T, C -> G, G -> C, T -> A.
An important special case is start=13, stop=13:
If seq is a vector of 25mer sequences on an Affymetrix
GeneChip, complementSeq(seq, start=13, stop=13)
calculates the so-called mismatch sequences.
The function deals only with sequences that represent DNA.
These can consist only of the letters A, C, T
or G. Upper, lower or mixed case is allowed and honored.
A character vector of the same length as seq is
returned. Each component represents the transformed sequence for the
input value.
R. Gentleman, W. Huber
alphabetFrequency, reverseComplement
## ---------------------------------------------------------------------
## EXAMPLE 1
## ---------------------------------------------------------------------
seq <- c("AAACT", "GGGTT")
## Don't do this anymore (deprecated):
if (interactive()) {
complementSeq(seq) # inefficient on large vectors
}
## But do this instead:
complement(DNAStringSet(seq)) # more efficient
## ---------------------------------------------------------------------
## EXAMPLE 2
## ---------------------------------------------------------------------
seq <- c("CGACTGAGACCAAGACCTACAACAG", "CCCGCATCATCTTTCCTGTGCTCTT")
## Don't do this anymore (deprecated):
if (interactive()) {
complementSeq(seq, start=13, stop=13)
}
## But do this instead:
pm2mm <- function(probes)
{
probes <- DNAStringSet(probes)
subseq(probes, start=13, end=13) <- complement(subseq(probes, start=13, end=13))
probes
}
pm2mm(seq)
## ---------------------------------------------------------------------
## SPEED OF complementSeq() VS complement()
## ---------------------------------------------------------------------
if (interactive()) {
library(hgu95av2probe)
system.time(y1 <- complementSeq(hgu95av2probe$sequence))
probes <- DNAStringSet(hgu95av2probe)
system.time(y2 <- complement(probes))
}